Pictogram is a handy tool to help you visualize sequence alignments and consensus sequences. Input your short DNA sequences, and the web server will create an image like that above, showing the relative frequencies of the bases at each position. You can specify known background frequencies of bases, for a normalized version of the output. The program outputs postscript and PDF, for easy viewing and printing.
Each sequence must be the same length. Input sequences as a FastA file with one sequence per line (no linebreaks), or as raw sequence (again, one sequence per line). Letters in the sequence other than ATCGU will be ignored or, at worst, crash the program.
An example in FastA form:
>primer: phiX reverse complement 2588 (i.e phiX2798) TGACTATTGACGTCCTTCCCCGTAC >primer: phiX 5366, misannealed at phiXRC 2036 TATGGCTAAAGCTGGTAAAGGACTT
The options to the program are described in the form below.
Enter OUTPUT file name: (REQUIRED)
Output Format. Portrait is default. If sequences are >20bp long, check box for Landscape output:
Do you want to calculate and plot the information content at each position in BITS? (Check if YES, default is NO)
Do you want the alignment to start at a particular base position? (default is 1st base of alignment, OR enter another number)
Do you want to compensate for small sample size (25 samples or less)? (Check if YES, default is NO)
Do you want to vary the background frequencies of each base? Default is 25% each A, C, G, T. Enter other frequencies below:
A C G T
Enter your Fasta format DNA sequences here: